CpG-Oligonukleotid 1018

Nukleinsäure
TGACTGTGAACGTTCGAGATGA
Allgemeines
Name CpG 1018
Andere Namen

1018 ISS

Identifikatoren
GenBank JC507052.1
CAS-Nummer 937402-51-2
PubChem 472404001
Wirkstoffdaten
DrugBank DB05463
Eigenschaften
Größe

22 Nukleotide, 7150 Da

Taxon synthetisch

CpG-Oligonukleotid 1018 (auch CpG 1018) ist ein CpG-Oligonukleotid, das an den TLR9 bindet und daher in der Immunologie und Pharmakologie als Adjuvans verwendet wird.

Eigenschaften

Wirkungen unterschiedlicher CpG-Klassen

CpG 1018 wird synthetisch per Phosphoramidit-Methode hergestellt.[1] CpG 1018 ist ein CpG-Oligonukleotid der Klasse B[2] und hat die Sequenz: 5′-TGACTGTGAACGTTCGAGATGA-3′.[3] Das erste CG in der Sequenz wirkt am TLR-9 in Nagetieren, während das zweite in Primaten wirksam ist.[3] Das Phosphodiester-Desoxyribose-Rückgrat ist hierbei zu einem Phosphorthioat modifiziert.[3] Dabei wird ein nicht an der Phosphatbrücke beteiligtes Sauerstoffatom durch ein Schwefelatom ersetzt.[4] Dadurch wird es resistenter gegenüber DNasen. CpG 1018 erzeugt bei einer Immunisierung eine TH1-gerichtete Immunantwort mit einer Produktion von Chemokinen, Zytokinen und Antikörpern in NK-Zellen, pDC und B-Zellen.[5][6]

Anwendungen

CpG 1018 ist im monovalenten Hepatitis-B-Impfstoff Heplisav-B, der 2021 in der EU zugelassen wurde, als Adjuvans enthalten.[7] CpG 1018 ist ferner Bestandteil eines COVID-19-Impfstoffes in Form eines inaktivierten Virus gegen das Coronavirus SARS-CoV-2, der 2022 bis 2023[8] als COVID-19-Impfstoff (inaktiviert, adjuvantiert) Valneva (Hersteller: Valneva)[9] zugelassen war.

Literatur

  • Immunostimulatory DNA–Dynavax. AIC, Amb a 1 immunostimulatory conjugate, HBV-ISS, ISS 1018, ISS DNA, ISS DNA–dynavax, ISS1, ISS2. In: Drugs in R&D. Band 3, Nummer 3, 2002, S. 193–196, doi:10.2165/00126839-200203030-00011, PMID 12099166
  • A. M. Krieg, A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman: CpG motifs in bacterial DNA trigger direct B-cell activation. In: Nature. Band 374, Nummer 6522, April 1995, S. 546–549, doi:10.1038/374546a0, PMID 7700380.

Einzelnachweise

  1. ↑ Jason D. Marshall, Karen Fearon, Christi Abbate, Sandhya Subramanian, Priscilla Yee, Josh Gregorio, Robert L Coffman, Gary Van Nest: Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions In: Journal of leukocyte biology. Band 73, Nummer 6, Juni 2003, S. 781–792, doi:10.1189/jlb.1202630, PMID 12773511.
  2. ↑ Jingxing Yang, Jen-Chih Tseng, Guann-Yi Yu, Yunping Luo, Chi-Ying F. Huang, Yi-Ren Hong, Tsung-Hsien Chuang: Recent Advances in the Development of Toll-like Receptor Agonist-Based Vaccine Adjuvants for Infectious Diseases. In: Pharmaceutics. 2022, Band 14, Nummer 2, S. 423 doi:10.3390/pharmaceutics14020423. PMID 35214155. PMC 8878135 (freier Volltext).
  3. ↑ a b c John D. Campbell: Development of the CpG Adjuvant 1018: A Case Study. In: Methods in Molecular Biology (Clifton, N.J.). Band 1494, 2017, S. 15–27, doi:10.1007/978-1-4939-6445-1_2, PMID 27718183.
  4. ↑ Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto jr., Lubert Stryer: Stryer Biochemie. Katalytische Strategien. 8. Auflage. Springer, 2018, ISBN 978-3-662-54619-2, S. 321, doi:10.1007/978-3-662-54620-8_9.
  5. ↑ A. Facciolà, G. Visalli, A. Laganà, A. Di Pietro: An Overview of Vaccine Adjuvants: Current Evidence and Future Perspectives. In: Vaccines. Band 10, Nummer 5, Mai 2022, S. , doi:10.3390/vaccines10050819, PMID 35632575, PMC 9147349 (freier Volltext).
  6. ↑ M. Roman, E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz: Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. In: Nature medicine. Band 3, Nummer 8, August 1997, S. 849–854, doi:10.1038/nm0897-849, PMID 9256274.
  7. ↑ Heplisav B. In: EMA. Abgerufen am 10. Juli 2022 (englisch).
  8. ↑ Eintrag EU/1/21/1624 im Unionsregister.
  9. ↑ Valneva Provides Regulatory Update on its COVID-19 Vaccine Candidate. In: Mitteilung. Valneva SE, 11. März 2022, abgerufen am 2. April 2022.